| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.157806 |
| Chromosome: | chromosome 10 |
| Location: | 916207 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424400 | PBB1 | 20S proteasome beta subunit B, type beta 2; (1 of 1) K02739 - 20S proteasome subunit beta 2 (PSMB7) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAAGTCAAAGCACGCCAACCGCACATTTG |
| Internal bar code: | CCCGGGGATATGCCACGCATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1085 |
| LEAP-Seq percent confirming: | 99.0989 |
| LEAP-Seq n confirming: | 5389 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCGCTTCCAGCCAGATTA |
| Suggested primer 2: | TAGGTGCTGCTTGAACATGG |