| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.157832 |
| Chromosome: | chromosome 11 |
| Location: | 2702183 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g476850 | PF2,DRC4,GAS8 | (1 of 1) PTHR31543//PTHR31543:SF0 - FAMILY NOT NAMED // GROWTH ARREST-SPECIFIC PROTEIN 8; Nexin-dynein regulatory complex 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAGCCTGAACCCGAAGCCATGGGGTGGA |
| Internal bar code: | ACGTGGGTCCTAATCTTCGAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 78 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCCTCCTACACCCAGTGC |
| Suggested primer 2: | CTCGACACACATATCCACGG |