| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.157853 |
| Chromosome: | chromosome 17 |
| Location: | 7013518 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g746597 | (1 of 2) K16296 - serine carboxypeptidase-like clade I [EC:3.4.16.-] (SCPL-I) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACATGACAGGGCAGCGAAGGCTTCTGGTG |
| Internal bar code: | GTCCCACGCGGAACGCGATACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 469 |
| LEAP-Seq percent confirming: | 99.6484 |
| LEAP-Seq n confirming: | 1417 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGAGCCTGAGAGGAATC |
| Suggested primer 2: | TCCAGGTCGAGGTGTAGGTT |