| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.157874 |
| Chromosome: | chromosome 10 |
| Location: | 4811894 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g454000 | (1 of 2) IPR000157//IPR016024 - Toll/interleukin-1 receptor homology (TIR) domain // Armadillo-type fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGTGGAGATTCTCCACCAGCTCGAGCC |
| Internal bar code: | GTCAATCAAGTGGGAGGCCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 814 |
| LEAP-Seq percent confirming: | 99.8923 |
| LEAP-Seq n confirming: | 1855 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGATTACTAATGCCCCGA |
| Suggested primer 2: | CCATTGTGTGTCCTCACCAG |