| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.157962 |
| Chromosome: | chromosome 5 |
| Location: | 806451 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g248150 | PGA2 | 1-acylglycerophosphocholine O-acyltransferase; (1 of 3) 2.3.1.25 - Plasmalogen synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAATGCCTCCAGCAGCTCTCCTCGGCCGC |
| Internal bar code: | GGAGTGCGAATTGGCTAAGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 911 |
| LEAP-Seq percent confirming: | 99.8093 |
| LEAP-Seq n confirming: | 6280 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCATCATAGCGCTGACT |
| Suggested primer 2: | TTAGTCAACCGTCTCCCACC |