| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.157970 |
| Chromosome: | chromosome 16 |
| Location: | 2674457 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662100 | (1 of 10) IPR004087//IPR004088 - K Homology domain // K Homology domain, type 1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGCAGGCGAGGCCGCACCAAGGTTTAAG |
| Internal bar code: | CGGCCGGGTAGGGTGCGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 969 |
| LEAP-Seq percent confirming: | 99.5174 |
| LEAP-Seq n confirming: | 3093 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGTTGTTGCTGATGCTC |
| Suggested primer 2: | GAGCGCCAGAGTCACATACA |