| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.158017 |
| Chromosome: | chromosome 16 |
| Location: | 4481246 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667450 | TLP2 | (1 of 3) PF01167 - Tub family (Tub); Tubby-Like Protein 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGATGCAGGCGTGCTCGGGGCCAGCAAC |
| Internal bar code: | TACTTTACTCGAAACATAGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 918 |
| LEAP-Seq percent confirming: | 99.4748 |
| LEAP-Seq n confirming: | 9471 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGAAGGCCTGTGAGTTCT |
| Suggested primer 2: | GCTCAAACGCAGAGATTTCC |