Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.158065 |
Chromosome: | chromosome 16 |
Location: | 549799 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g692550 | MSH4 | DNA mismatch repair protein, MutS homolog; (1 of 1) K08740 - DNA mismatch repair protein MSH4 (MSH4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGGCAGATAGAGGCAGTGCAATCACAA |
Internal bar code: | GCTTCCCGGGTCAAGCCCGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 409 |
LEAP-Seq percent confirming: | 25.6515 |
LEAP-Seq n confirming: | 1565 |
LEAP-Seq n nonconfirming: | 4536 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGAAGGAGATGGAGGGAC |
Suggested primer 2: | ACTCATCATCAACGCCATCA |