| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158076 |
| Chromosome: | chromosome 9 |
| Location: | 675236 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403000 | PAP9 | (1 of 3) K03514 - non-canonical poly(A) RNA polymerase PAPD5/7 (PAPD5_7, TRF4); Class-II RNA nucleotidyl transferase 9 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCCCCGCTGCCCGCCACCTACAGACCTC |
| Internal bar code: | GTCGGTAAGTTGATGTGTGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 199 |
| LEAP-Seq percent confirming: | 92.7711 |
| LEAP-Seq n confirming: | 231 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGTGTTCGTGTGTTAGG |
| Suggested primer 2: | ACAGGACAGGACAGGACAGG |