Insertion junction: LMJ.RY0402.158112_3

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.158112
Chromosome:chromosome_17
Location:5611602
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre17.g738050 AGG4 Flagellar membrane protein, paralog of AGG2 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ACCAGCCTGCTCTGCGTCTGTCGCTGTCGC
Internal bar code:GTTTATTGTTCATAAGCTGGAC

Confirmation - LEAP-Seq

LEAP-Seq distance:466
LEAP-Seq percent confirming:99.6416
LEAP-Seq n confirming:3336
LEAP-Seq n nonconfirming:12
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:GACAGTACGCGCCTAAAAGC
Suggested primer 2:GCGACTGCTAGATAGGCACC