Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.158115 |
Chromosome: | chromosome 7 |
Location: | 2120141 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g326350 | (1 of 54) IPR001680//IPR017986 - WD40 repeat // WD40-repeat-containing domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCACGCGATGTACGATATGATGCACGCC |
Internal bar code: | CAAACGGTGAGTTCCGGAGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 899 |
LEAP-Seq percent confirming: | 99.6101 |
LEAP-Seq n confirming: | 1022 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACACAAATGTGCCATCA |
Suggested primer 2: | GGGGAGACCGTGTACGACTA |