| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158187 |
| Chromosome: | chromosome 4 |
| Location: | 1902857 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g218050 | RWP8 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGACACCCAAGAGACGAGTCCTGAGAC |
| Internal bar code: | GGGTCGAACGGGGGGGCCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1033 |
| LEAP-Seq percent confirming: | 99.8094 |
| LEAP-Seq n confirming: | 4189 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGTGCTCCAACCGTACAT |
| Suggested primer 2: | CATTGCTCGCTGGACTTGTA |