| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.158202 |
| Chromosome: | chromosome 2 |
| Location: | 6301846 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g114750 | CDKP6,CDPK6,CDPK4 | (1 of 6) PTHR24349//PTHR24349:SF23 - SERINE/THREONINE-PROTEIN KINASE // MAP KINASE-ACTIVATED PROTEIN KINASE 5; Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAAGAAGCAACCACCCACCCCACCTCAG |
| Internal bar code: | GTCGACCCACGACAGAGCGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 413 |
| LEAP-Seq percent confirming: | 78.6802 |
| LEAP-Seq n confirming: | 155 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCCCTTCTTCATCAGAGC |
| Suggested primer 2: | AAGGACGTCATCAGGCGTAT |