Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.158231 |
Chromosome: | chromosome 1 |
Location: | 4060697 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g026550 | CCT7 | T-complex protein 1, eta subunit; (1 of 1) K09499 - T-complex protein 1 subunit eta (CCT7) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGCAACAACATATGGGCAACTGGGTTG |
Internal bar code: | CGCAAATGCAGGGACGAGTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 988 |
LEAP-Seq percent confirming: | 99.8388 |
LEAP-Seq n confirming: | 1858 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTCTGTCGGTGGACGAGAC |
Suggested primer 2: | GGTATAGCATGGCGGTGAGT |