Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.158261 |
Chromosome: | chromosome 1 |
Location: | 5758207 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g041100 | HLM3 | (1 of 1) PTHR12197:SF75 - HISTONE-LYSINE N-METHYLTRANSFERASE ATXR2; Histone-lysine N-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAATCAGCTCGTAATCGGCCTGACACCCC |
Internal bar code: | CCCTCGGGCCTAGCGGGCAATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 724 |
LEAP-Seq percent confirming: | 99.0148 |
LEAP-Seq n confirming: | 603 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACCGTCTGACCACAGAAT |
Suggested primer 2: | TACACCGCTCGCACTTACAC |