| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158322 |
| Chromosome: | chromosome 6 |
| Location: | 2280976 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g266900 | LPA1L | Low PSII Accumulation 1 homolog; (1 of 2) PF11998 - Protein of unknown function (DUF3493) (DUF3493) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGCCTGGCGGCCTCAGAGCCGACACCT |
| Internal bar code: | GGCTTTCCGGCTATCGTAGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 549 |
| LEAP-Seq percent confirming: | 87.7922 |
| LEAP-Seq n confirming: | 338 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGGCCTGCTTCACAAGTC |
| Suggested primer 2: | GAAGTCCTGGTTTGAGCAGC |