| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158353 |
| Chromosome: | chromosome 10 |
| Location: | 5224232 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g457000 | CYN65 | Cyclophilin 65; (1 of 1) K10598 - peptidyl-prolyl cis-trans isomerase-like 2 (PPIL2, CYC4, CHP60) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCGCCTTCCGTTCTCGCCACCGAAACT |
| Internal bar code: | GGGATACGTTCGCGCCGTTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1010 |
| LEAP-Seq percent confirming: | 99.8005 |
| LEAP-Seq n confirming: | 1501 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGCCACAGACGACATGAA |
| Suggested primer 2: | TCACCTTCCCATACTGCACA |