| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.158395 |
| Chromosome: | chromosome 9 |
| Location: | 1037135 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400800 | (1 of 4) IPR000719//IPR001229//IPR002290//IPR011009//IPR020635 - Protein kinase domain // Jacalin-like lectin domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACACTGGATTACAAGCCGTTGAAGCCA |
| Internal bar code: | GAGGAGGTTCTGGAGACAGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1012 |
| LEAP-Seq percent confirming: | 99.6602 |
| LEAP-Seq n confirming: | 1173 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTTTCAACCCCAGCTACC |
| Suggested primer 2: | CCACGAGAAATAAAGCGAGC |