| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.158412 |
| Chromosome: | chromosome 9 |
| Location: | 7845448 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g416750 | CCT2 | T-complex protein 1, beta subunit; (1 of 1) K09494 - T-complex protein 1 subunit beta (CCT2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCACCATCCTCACCCAGTCCATTCCTG |
| Internal bar code: | TGGACGCGAGTGTCGTTTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 533 |
| LEAP-Seq percent confirming: | 99.422 |
| LEAP-Seq n confirming: | 172 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTCATTCCTGACACTGC |
| Suggested primer 2: | GGACGGCGATAGTGAAACAT |