| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158542 |
| Chromosome: | chromosome 10 |
| Location: | 1247789 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426750 | CYP739A5,CYP29 | (1 of 1) 1.14.13.159 - Vitamin D 25-hydroxylase / Vitamin D(3) 25-hydroxylase; Cytochrome P450, CYP120 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACTCACCATATGATTGTGCCTACAGCA |
| Internal bar code: | ACGTGGTCGGTGTCGCGAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 99.6347 |
| LEAP-Seq n confirming: | 1909 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGTAGCAGCTTCACCTCC |
| Suggested primer 2: | CTCCTCAGCTACCTGGATGC |