| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158563 |
| Chromosome: | chromosome 9 |
| Location: | 2729319 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389450 | (1 of 1) IPR000104//IPR000504//IPR003613//IPR012677//IPR013083//IPR016024//IPR020683 - Antifreeze protein, type I // RNA recognition motif domain // U box domain // Nucleotide-binding alpha-beta plait domain // Zinc finger, RING/FYVE/PHD-type // Armadillo-type fold // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCAAGCAGGATCTAGTCGGGGCATGGC |
| Internal bar code: | GATGCATGATCGAAACCTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 766 |
| LEAP-Seq percent confirming: | 85.8038 |
| LEAP-Seq n confirming: | 2055 |
| LEAP-Seq n nonconfirming: | 340 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTGCACATCCAGGAAAGG |
| Suggested primer 2: | CTCAGACAGCTGCGAATCAC |