| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158606 |
| Chromosome: | chromosome 2 |
| Location: | 3485316 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095122 | FKB16H,FKB16-8,FKB11 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 25) PTHR10516 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTACCTCCTGCCCGATTTTGGTGACTTC |
| Internal bar code: | GAGTGGGATGATGGGGGTGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 713 |
| LEAP-Seq percent confirming: | 90.2041 |
| LEAP-Seq n confirming: | 442 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTGTAGCTCCGAGACAAG |
| Suggested primer 2: | GGGCGCATGCATATAGAAAT |