| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.158608 |
| Chromosome: | chromosome 13 |
| Location: | 1907683 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g575950 | HIRA1,HIR1 | (1 of 1) K11293 - protein HIRA/HIR1 (HIRA, HIR1); Histone transcription regulator | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCTCGCGGCGGCAACCCGGGTATCTTG |
| Internal bar code: | AGCTCTAGCATTCGGGGACTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 942 |
| LEAP-Seq percent confirming: | 99.4651 |
| LEAP-Seq n confirming: | 5021 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAACTTGGGTGGACACGCT |
| Suggested primer 2: | TGGATGCGAGTCTACAGTGC |