| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.158752 |
| Chromosome: | chromosome 14 |
| Location: | 1325869 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616950 | SELENOT,SELT,SELT1 | (1 of 1) PTHR13544:SF0 - SELENOPROTEIN T; Selenoprotein T | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACTCCATCTTCGTGCACGCACCGCCGTC |
| Internal bar code: | CGTGAGCATGAACGCTCGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 638 |
| LEAP-Seq percent confirming: | 92.8191 |
| LEAP-Seq n confirming: | 349 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAGACACAGCCACAGCAC |
| Suggested primer 2: | TTGGATCTAGGCAAAAACCG |