Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.158801 |
Chromosome: | chromosome 12 |
Location: | 4828783 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g524700 | HAD4 | Haloacid dehalogenase-like hydrolase; (1 of 1) K18551 - pyrimidine and pyridine-specific 5'-nucleotidase (SDT1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCAAAGGCAGGCCAGAGTAAGACGCGT |
Internal bar code: | TGGGCAGTAGCCAAAGTGCGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 862 |
LEAP-Seq percent confirming: | 99.4436 |
LEAP-Seq n confirming: | 1966 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACACCTACATTTGGGCAGG |
Suggested primer 2: | CTACTGCTTCCCCGACTCAG |