| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.158830 |
| Chromosome: | chromosome 17 |
| Location: | 1767373 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g709250 | (1 of 1) PTHR23137:SF3 - VESICLE TRANSPORT PROTEIN SFT2C | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCTCCTCTTGCCACTGTGGCAGCCTCC |
| Internal bar code: | AGGCGGAATTCGGCGCAGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1085 |
| LEAP-Seq percent confirming: | 55.0665 |
| LEAP-Seq n confirming: | 4554 |
| LEAP-Seq n nonconfirming: | 3716 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGAATGTTCAGGCTGTGAG |
| Suggested primer 2: | CTCTTTCAGGCTACATCGGC |