| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.158880 |
| Chromosome: | chromosome 12 |
| Location: | 1818956 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g511950 | (1 of 1) IPR003591//IPR013210 - Leucine-rich repeat, typical subtype // Leucine-rich repeat-containing N-terminal, plant-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGGCTGTGACGGCACCCAGCAGCGCGAC |
| Internal bar code: | CGGACACGGCTTGTTTCGAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 156 |
| LEAP-Seq percent confirming: | 82.9694 |
| LEAP-Seq n confirming: | 950 |
| LEAP-Seq n nonconfirming: | 195 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAAGGAAAGGGAGGTGAA |
| Suggested primer 2: | AGAAGCCGCAAAGTAGGACA |