| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.158887 |
| Chromosome: | chromosome 11 |
| Location: | 1868720 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g468050 | VIPP2 | (1 of 2) K03969 - phage shock protein A (pspA); Vesicle inducing protein in plastids 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAATCAAATGAGCCTCAGTCTTTCGGTT |
| Internal bar code: | ACGTGGGTTCGATTAAAGGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 380 |
| LEAP-Seq percent confirming: | 99.6663 |
| LEAP-Seq n confirming: | 2389 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTCAAGACGGAGATTGAA |
| Suggested primer 2: | ATACCGTGATGTGGGATGGT |