Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.158948 |
Chromosome: | chromosome 16 |
Location: | 6081399 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676000 | (1 of 102) PF01753 - MYND finger (zf-MYND) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCACAGGAGCTTCTGCGCGAGCTTGAGG |
Internal bar code: | CCTTACGTGTGTTTGTCCGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 258 |
LEAP-Seq percent confirming: | 99.6726 |
LEAP-Seq n confirming: | 4567 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCTCCTGCTCCTCCTCCTC |
Suggested primer 2: | TACACGCTCACAGTTACGGC |