| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.158961 |
| Chromosome: | chromosome 4 |
| Location: | 3675570 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228900 | PPP19 | (1 of 1) K17618 - ubiquitin-like domain-containing CTD phosphatase 1 [EC:3.1.3.16] (UBLCP1); Phosphoprotein phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGTTTGGAGGGTACGTCGGGTGGGGCGC |
| Internal bar code: | TGGTTGTTATTAAAGCATCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 408 |
| LEAP-Seq percent confirming: | 98.0234 |
| LEAP-Seq n confirming: | 2182 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | ACTGGGGAGTGTTGAATTGC |