| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.159016 |
| Chromosome: | chromosome 17 |
| Location: | 405614 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g698850 | ISA2,STA8 | (1 of 2) 3.2.1.68 - Isoamylase / Debranching enzyme; Isoamylase-type starch debranching enzyme 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGCGAGGGGCCGGGCGCGGACAGGCAC |
| Internal bar code: | TCGAAGAGGAGGGCTGAACTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 554 |
| LEAP-Seq percent confirming: | 66.0714 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGAGTGCAGTGCTGTGT |
| Suggested primer 2: | GTGCGATCAGGATGCTTGTA |