| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.159050 |
| Chromosome: | chromosome 1 |
| Location: | 55827 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000300 | GDP8,CGI58 | (1 of 1) K13535 - cardiolipin-specific phospholipase (CLD1); Esterase/lipase/thioesterase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCATATGTGGCCGCCAGGTAGCCGCCCA |
| Internal bar code: | ATTTAGTGCTCGGCTTACCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 228 |
| LEAP-Seq percent confirming: | 99.7595 |
| LEAP-Seq n confirming: | 7051 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCAGCTTGGAATTGTGTC |
| Suggested primer 2: | GATGATCTCCACCGACAGGT |