| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.159105 |
| Chromosome: | chromosome 13 |
| Location: | 4651746 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g604250 | (1 of 1) IPR002889//IPR003882//IPR013994 - Carbohydrate-binding WSC // Pistil-specific extensin-like protein // Carbohydrate-binding WSC, subgroup | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCAATTGTACTGCGACGCGCACTGCCC |
| Internal bar code: | ACCCTAGCGACCTTATACTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 846 |
| LEAP-Seq percent confirming: | 99.5639 |
| LEAP-Seq n confirming: | 1598 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCAATGACATTTTCGGA |
| Suggested primer 2: | GTAAGTGGCACACGGAGGTT |