Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.159161 |
Chromosome: | chromosome 13 |
Location: | 3653603 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g588750 | (1 of 14) PF04577 - Protein of unknown function (DUF563) (DUF563) | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTGTTGCTTTAGCTTTGCTGTGCCCCAG |
Internal bar code: | GAAGCGAAGCCAATCGTGGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 896 |
LEAP-Seq percent confirming: | 99.5409 |
LEAP-Seq n confirming: | 1084 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGTTGTTGTTGCTGCTGT |
Suggested primer 2: | TGGACTATGTGGCTCAGCAG |