| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.159206 |
| Chromosome: | chromosome 7 |
| Location: | 1612649 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325000 | CYP18,CYP738A1 | Cytochrome P450, CYP120 superfamily; (1 of 4) 1.14.13.93 - (+)-abscisic acid 8'-hydroxylase / ABA 8'-hydroxylase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAAATGCTTCGGGGGCCTGGGCCACAGC |
| Internal bar code: | GCAAAGGCGGGTTCCACTACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1075 |
| LEAP-Seq percent confirming: | 99.6095 |
| LEAP-Seq n confirming: | 3316 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCATGCCGTGTTGTTTAG |
| Suggested primer 2: | TCATGCACATCCTAGCAAGC |