| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.159324 |
| Chromosome: | chromosome 7 |
| Location: | 894412 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318800 | HSP22A | (1 of 2) K13993 - HSP20 family protein (HSP20); heat shock protein 22A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCCAGGGGTGCTAGCTGTTTCTTACCAG |
| Internal bar code: | GCTTCTGCCTACGATACCCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 209 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 177 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCATTAACGCCCTACCCAG |
| Suggested primer 2: | TGGAAGTCGGGCTAGCTTTA |