| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.159388 |
| Chromosome: | chromosome 6 |
| Location: | 6453147 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g292750 | (1 of 2) PF05694 - 56kDa selenium binding protein (SBP56) (SBP56) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGTTGAGGTCCATGTATGCCGACGGCGC |
| Internal bar code: | CACCCAGGTTTCTCGGGGGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 925 |
| LEAP-Seq percent confirming: | 97.4893 |
| LEAP-Seq n confirming: | 2058 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGTAATATCCATGCATCC |
| Suggested primer 2: | GGGTTCAAAAGCTCAGTTGC |