| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.159393 |
| Chromosome: | chromosome 16 |
| Location: | 6849642 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675861 | SUMO3 | (1 of 9) PTHR10562 - SMALL UBIQUITIN-RELATED MODIFIER; Small ubiquitin-like modifier (SUMO) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTCCTGCTAATCCTGAGCGGGTTCACAT |
| Internal bar code: | TTGGCGCCATGTGAGAGGTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 99.3215 |
| LEAP-Seq n confirming: | 1171 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTCTAGGAAGGCAACCCC |
| Suggested primer 2: | ACTACGGGTGGACAGGTGAG |