Insertion junction: LMJ.RY0402.159472_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.159472
Chromosome:chromosome_8
Location:4151434
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GCTTGGCGGCGGCGGGACAGGCGGCGGGAG
Internal bar code:TCCCTACAGGCCAGACTTGAGA

Confirmation - LEAP-Seq

LEAP-Seq distance:95
LEAP-Seq percent confirming:96.3636
LEAP-Seq n confirming:53
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR

Suggested primer 1:TTGTAACGACAGCTTGCGAC
Suggested primer 2:TTTTCCTGTGCTTTCCTGCT