Insertion junction: LMJ.RY0402.159478_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.159478
Chromosome:chromosome_6
Location:1731189
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g261750 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGCCTTGAGGCGGGCGTGCTGCCCTCCTA
Internal bar code:GAGTAGGGGTCATGGTAGCGGG

Confirmation - LEAP-Seq

LEAP-Seq distance:666
LEAP-Seq percent confirming:99.883
LEAP-Seq n confirming:5121
LEAP-Seq n nonconfirming:6
LEAP-Seq n unique pos:25

Suggested primers for confirmation by PCR

Suggested primer 1:GAGCTTCGTGGATGGATGTT
Suggested primer 2:GTATGAAGGTCACCGCCTGT