Insertion junction: LMJ.RY0402.159504_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.159504
Chromosome:chromosome_2
Location:5090054
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g104900 FAP204 Flagellar Associated Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CACCCGCAATCACGCACCTCCTTGTTGAGG
Internal bar code:GTGAGTTACAAGGAAGCAAAAA

Confirmation - LEAP-Seq

LEAP-Seq distance:745
LEAP-Seq percent confirming:99.9057
LEAP-Seq n confirming:1059
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:GTCCTTCTCGTCTGCAGGTC
Suggested primer 2:TGAAAGCTTGGTGCTGAATG