| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.159544 |
| Chromosome: | chromosome 14 |
| Location: | 3967506 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633300 | (1 of 1) IPR003582//IPR006626//IPR009030 - ShKT domain // Parallel beta-helix repeat // Insulin-like growth factor binding protein, N-terminal | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGACAGGGGGCAGGGGGCTGCCTGCAC |
| Internal bar code: | AAATCCTTCGGTAGAGTAGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 343 |
| LEAP-Seq percent confirming: | 98.2534 |
| LEAP-Seq n confirming: | 2644 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCAGTAGTGGCAGCAGAA |
| Suggested primer 2: | CCCACCCTACCACTTCCTTT |