| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.159645 |
| Chromosome: | chromosome 11 |
| Location: | 3104857 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479000 | CYG7 | (1 of 11) 4.6.1.1//4.6.1.2 - Adenylate cyclase / ATP pyrophosphate-lyase // Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGCGTGAGCGTGTGTCTGCCGGAATGCG |
| Internal bar code: | CGCGTGTCGGCAGCAGTGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1011 |
| LEAP-Seq percent confirming: | 98.9815 |
| LEAP-Seq n confirming: | 2624 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACACTCGCCATCATTCTCA |
| Suggested primer 2: | TCAAGAAGGGTTTGGGACAG |