| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.159678 |
| Chromosome: | chromosome 13 |
| Location: | 157646 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g563200 | HAD7 | Haloacid dehalogenase-like hydrolase; (1 of 1) PTHR12725:SF63 - ALPHA-D-GLUCOSE-1-PHOSPHATE PHOSPHATASE YIHX | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAACAACCCCAGAAGCGTTCAGTGGTGGT |
| Internal bar code: | ACGCACGACCTCGTGGCTGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 745 |
| LEAP-Seq percent confirming: | 98.6786 |
| LEAP-Seq n confirming: | 2091 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGTTACAGAGAGCCAGC |
| Suggested primer 2: | ACACACCCAGTCTAGTGCCC |