| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.159731 |
| Chromosome: | chromosome 1 |
| Location: | 3432421 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g021900 | PUS11 | (1 of 1) PTHR11142:SF10 - TRNA PSEUDOURIDINE SYNTHASE; RNA pseudouridine synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATGTTTCAGACGTTGCAGGGCGACGGTG |
| Internal bar code: | TGAGTTGTTTGGCCCATGTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 468 |
| LEAP-Seq percent confirming: | 94.4659 |
| LEAP-Seq n confirming: | 734 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACATGAACGAGAACCGCA |
| Suggested primer 2: | CCGTCAACAGTGGTGTCAAC |