Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.159889 |
Chromosome: | chromosome 1 |
Location: | 4823951 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g033400 | TIM9 | Mitochondrial inner membrane translocase subunit; (1 of 1) K17777 - mitochondrial import inner membrane translocase subunit TIM9 (TIM9) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGCGAACCCACCAACAGACCAACTCGA |
Internal bar code: | GGAGGCGCGCCATGGGGTGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 956 |
LEAP-Seq percent confirming: | 99.6212 |
LEAP-Seq n confirming: | 7890 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATGCGCTTCCAAGAGTTC |
Suggested primer 2: | AAGCTCACGAGCTGGATTGT |