| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.159951 |
| Chromosome: | chromosome 13 |
| Location: | 2129458 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g577850 | FKB20,FKB20B,FKB20-2 | (1 of 1) PTHR10516:SF178 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP20-2, CHLOROPLASTIC; peptidyl-prolyl cis-trans isomerase, FKBP-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCGGCAAACGTACCGGTCCCCACGGCC |
| Internal bar code: | GCCTCGGAAACACAGGTGGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 892 |
| LEAP-Seq percent confirming: | 99.5752 |
| LEAP-Seq n confirming: | 3047 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGCAGCAGGTCAGCATTT |
| Suggested primer 2: | CATGGGCTACACCGTATCCT |