| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.160031 |
| Chromosome: | chromosome 10 |
| Location: | 2039778 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g432850 | FAP77,CFAP77 | Flagellar Associated Protein 77; (1 of 1) PTHR28617:SF1 - 1700101E01RIK PROTEIN | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATATCAACAGCATATGAATGTTTAGAG |
| Internal bar code: | GTCCGAACCCCCTGCGAACTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 658 |
| LEAP-Seq percent confirming: | 95.8333 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACCTGAGCATTGACAGC |
| Suggested primer 2: | ATACCGTGCGTTACCCCATA |