Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.160048 |
Chromosome: | chromosome 6 |
Location: | 5593252 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g285600 | MID,RWP5 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGAAGCGACGCACCCAATGACATTCTG |
Internal bar code: | CTGTCTAACGGTAAGCCGTATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 848 |
LEAP-Seq percent confirming: | 98.7826 |
LEAP-Seq n confirming: | 1136 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACATCTGCCCCGACTTAC |
Suggested primer 2: | TTGCGCTCAACATTTCAGAC |