| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.160166 |
| Chromosome: | chromosome 11 |
| Location: | 898753 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467656 | (1 of 9) IPR007112//IPR009009 - Expansin/pollen allergen, DPBB domain // RlpA-like double-psi beta-barrel domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGACGGGTTCGAAAGGGGTGCGCATCGC |
| Internal bar code: | TGTGGGTTGGGGGCTAGGCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 49 |
| LEAP-Seq percent confirming: | 99.084 |
| LEAP-Seq n confirming: | 649 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATCCCTGCGTATGTCTTT |
| Suggested primer 2: | CGTAGTCATCCTGGAGGGAA |